ID: 1156649676

View in Genome Browser
Species Human (GRCh38)
Location 18:39210644-39210666
Sequence CCAAGAAAATGAAGCATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156649676_1156649679 -10 Left 1156649676 18:39210644-39210666 CCACAGATGCTTCATTTTCTTGG No data
Right 1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156649676 Original CRISPR CCAAGAAAATGAAGCATCTG TGG (reversed) Intergenic
No off target data available for this crispr