ID: 1156649678

View in Genome Browser
Species Human (GRCh38)
Location 18:39210645-39210667
Sequence CACAGATGCTTCATTTTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156649673_1156649678 1 Left 1156649673 18:39210621-39210643 CCTCCTTTAATTGTTGTCCTTAA No data
Right 1156649678 18:39210645-39210667 CACAGATGCTTCATTTTCTTGGG No data
1156649674_1156649678 -2 Left 1156649674 18:39210624-39210646 CCTTTAATTGTTGTCCTTAACCA No data
Right 1156649678 18:39210645-39210667 CACAGATGCTTCATTTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156649678 Original CRISPR CACAGATGCTTCATTTTCTT GGG Intergenic
No off target data available for this crispr