ID: 1156649679

View in Genome Browser
Species Human (GRCh38)
Location 18:39210657-39210679
Sequence ATTTTCTTGGGTCATATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156649674_1156649679 10 Left 1156649674 18:39210624-39210646 CCTTTAATTGTTGTCCTTAACCA No data
Right 1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG No data
1156649675_1156649679 -4 Left 1156649675 18:39210638-39210660 CCTTAACCACAGATGCTTCATTT No data
Right 1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG No data
1156649673_1156649679 13 Left 1156649673 18:39210621-39210643 CCTCCTTTAATTGTTGTCCTTAA No data
Right 1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG No data
1156649676_1156649679 -10 Left 1156649676 18:39210644-39210666 CCACAGATGCTTCATTTTCTTGG No data
Right 1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156649679 Original CRISPR ATTTTCTTGGGTCATATAAT TGG Intergenic
No off target data available for this crispr