ID: 1156651847

View in Genome Browser
Species Human (GRCh38)
Location 18:39234886-39234908
Sequence GATGACTTCCATTCAAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156651840_1156651847 26 Left 1156651840 18:39234837-39234859 CCCTGTTGACCAGCCTGGAAGTA No data
Right 1156651847 18:39234886-39234908 GATGACTTCCATTCAAAGAGAGG No data
1156651844_1156651847 13 Left 1156651844 18:39234850-39234872 CCTGGAAGTAAGGCAATGTAATT No data
Right 1156651847 18:39234886-39234908 GATGACTTCCATTCAAAGAGAGG No data
1156651841_1156651847 25 Left 1156651841 18:39234838-39234860 CCTGTTGACCAGCCTGGAAGTAA No data
Right 1156651847 18:39234886-39234908 GATGACTTCCATTCAAAGAGAGG No data
1156651843_1156651847 17 Left 1156651843 18:39234846-39234868 CCAGCCTGGAAGTAAGGCAATGT No data
Right 1156651847 18:39234886-39234908 GATGACTTCCATTCAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156651847 Original CRISPR GATGACTTCCATTCAAAGAG AGG Intergenic
No off target data available for this crispr