ID: 1156658055

View in Genome Browser
Species Human (GRCh38)
Location 18:39310662-39310684
Sequence ACACCTCCTGTTGCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156658048_1156658055 18 Left 1156658048 18:39310621-39310643 CCCCTAGAGGTTTGAGAAGCGGG No data
Right 1156658055 18:39310662-39310684 ACACCTCCTGTTGCACATCCTGG No data
1156658052_1156658055 16 Left 1156658052 18:39310623-39310645 CCTAGAGGTTTGAGAAGCGGGGC No data
Right 1156658055 18:39310662-39310684 ACACCTCCTGTTGCACATCCTGG No data
1156658050_1156658055 17 Left 1156658050 18:39310622-39310644 CCCTAGAGGTTTGAGAAGCGGGG No data
Right 1156658055 18:39310662-39310684 ACACCTCCTGTTGCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156658055 Original CRISPR ACACCTCCTGTTGCACATCC TGG Intergenic
No off target data available for this crispr