ID: 1156658555

View in Genome Browser
Species Human (GRCh38)
Location 18:39317851-39317873
Sequence TCAAAGGTATACATCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156658551_1156658555 18 Left 1156658551 18:39317810-39317832 CCCTACAGAATTATAATGTAGCA No data
Right 1156658555 18:39317851-39317873 TCAAAGGTATACATCCTGACAGG No data
1156658553_1156658555 -5 Left 1156658553 18:39317833-39317855 CCTTCAACAGAAAGACAATCAAA No data
Right 1156658555 18:39317851-39317873 TCAAAGGTATACATCCTGACAGG No data
1156658550_1156658555 19 Left 1156658550 18:39317809-39317831 CCCCTACAGAATTATAATGTAGC No data
Right 1156658555 18:39317851-39317873 TCAAAGGTATACATCCTGACAGG No data
1156658552_1156658555 17 Left 1156658552 18:39317811-39317833 CCTACAGAATTATAATGTAGCAC No data
Right 1156658555 18:39317851-39317873 TCAAAGGTATACATCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156658555 Original CRISPR TCAAAGGTATACATCCTGAC AGG Intergenic
No off target data available for this crispr