ID: 1156663857

View in Genome Browser
Species Human (GRCh38)
Location 18:39381892-39381914
Sequence ATTCTGATATATGTGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156663857_1156663864 11 Left 1156663857 18:39381892-39381914 CCTTGTGCCACATATATCAGAAT No data
Right 1156663864 18:39381926-39381948 GACAAGAGGGAAAGAGATTGGGG No data
1156663857_1156663863 10 Left 1156663857 18:39381892-39381914 CCTTGTGCCACATATATCAGAAT No data
Right 1156663863 18:39381925-39381947 AGACAAGAGGGAAAGAGATTGGG No data
1156663857_1156663862 9 Left 1156663857 18:39381892-39381914 CCTTGTGCCACATATATCAGAAT No data
Right 1156663862 18:39381924-39381946 TAGACAAGAGGGAAAGAGATTGG No data
1156663857_1156663860 -3 Left 1156663857 18:39381892-39381914 CCTTGTGCCACATATATCAGAAT No data
Right 1156663860 18:39381912-39381934 AATGTGGATAATTAGACAAGAGG No data
1156663857_1156663861 -2 Left 1156663857 18:39381892-39381914 CCTTGTGCCACATATATCAGAAT No data
Right 1156663861 18:39381913-39381935 ATGTGGATAATTAGACAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156663857 Original CRISPR ATTCTGATATATGTGGCACA AGG (reversed) Intergenic
No off target data available for this crispr