ID: 1156666552

View in Genome Browser
Species Human (GRCh38)
Location 18:39415198-39415220
Sequence CTCATCTTGATAAACTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156666552_1156666554 6 Left 1156666552 18:39415198-39415220 CCTAAGGAGTTTATCAAGATGAG No data
Right 1156666554 18:39415227-39415249 ACTGAGGAAAATTGAGCTTAAGG No data
1156666552_1156666555 21 Left 1156666552 18:39415198-39415220 CCTAAGGAGTTTATCAAGATGAG No data
Right 1156666555 18:39415242-39415264 GCTTAAGGCTAAATTGATTTAGG No data
1156666552_1156666556 22 Left 1156666552 18:39415198-39415220 CCTAAGGAGTTTATCAAGATGAG No data
Right 1156666556 18:39415243-39415265 CTTAAGGCTAAATTGATTTAGGG No data
1156666552_1156666553 -10 Left 1156666552 18:39415198-39415220 CCTAAGGAGTTTATCAAGATGAG No data
Right 1156666553 18:39415211-39415233 TCAAGATGAGCATTCAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156666552 Original CRISPR CTCATCTTGATAAACTCCTT AGG (reversed) Intergenic