ID: 1156666556 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:39415243-39415265 |
| Sequence | CTTAAGGCTAAATTGATTTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156666552_1156666556 | 22 | Left | 1156666552 | 18:39415198-39415220 | CCTAAGGAGTTTATCAAGATGAG | No data | ||
| Right | 1156666556 | 18:39415243-39415265 | CTTAAGGCTAAATTGATTTAGGG | No data | ||||
| 1156666551_1156666556 | 23 | Left | 1156666551 | 18:39415197-39415219 | CCCTAAGGAGTTTATCAAGATGA | No data | ||
| Right | 1156666556 | 18:39415243-39415265 | CTTAAGGCTAAATTGATTTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156666556 | Original CRISPR | CTTAAGGCTAAATTGATTTA GGG | Intergenic | ||