ID: 1156666556

View in Genome Browser
Species Human (GRCh38)
Location 18:39415243-39415265
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156666552_1156666556 22 Left 1156666552 18:39415198-39415220 CCTAAGGAGTTTATCAAGATGAG No data
Right 1156666556 18:39415243-39415265 CTTAAGGCTAAATTGATTTAGGG No data
1156666551_1156666556 23 Left 1156666551 18:39415197-39415219 CCCTAAGGAGTTTATCAAGATGA No data
Right 1156666556 18:39415243-39415265 CTTAAGGCTAAATTGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156666556 Original CRISPR CTTAAGGCTAAATTGATTTA GGG Intergenic