ID: 1156666866

View in Genome Browser
Species Human (GRCh38)
Location 18:39419463-39419485
Sequence CTGTTTTAGTAGTTGGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156666864_1156666866 12 Left 1156666864 18:39419428-39419450 CCATTCAATGTTTACATTTTGGT No data
Right 1156666866 18:39419463-39419485 CTGTTTTAGTAGTTGGACTCAGG No data
1156666862_1156666866 24 Left 1156666862 18:39419416-39419438 CCAGTAAAGTTTCCATTCAATGT No data
Right 1156666866 18:39419463-39419485 CTGTTTTAGTAGTTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156666866 Original CRISPR CTGTTTTAGTAGTTGGACTC AGG Intergenic
No off target data available for this crispr