ID: 1156670087

View in Genome Browser
Species Human (GRCh38)
Location 18:39458501-39458523
Sequence TGTTGGAGGTAAAACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156670081_1156670087 7 Left 1156670081 18:39458471-39458493 CCAAATCTCATGTTGAAATGTAA 0: 567
1: 2965
2: 7294
3: 14959
4: 13729
Right 1156670087 18:39458501-39458523 TGTTGGAGGTAAAACCTGGTGGG No data
1156670080_1156670087 8 Left 1156670080 18:39458470-39458492 CCCAAATCTCATGTTGAAATGTA 0: 295
1: 1790
2: 10526
3: 12361
4: 9045
Right 1156670087 18:39458501-39458523 TGTTGGAGGTAAAACCTGGTGGG No data
1156670079_1156670087 11 Left 1156670079 18:39458467-39458489 CCACCCAAATCTCATGTTGAAAT 0: 200
1: 2545
2: 12820
3: 15577
4: 12330
Right 1156670087 18:39458501-39458523 TGTTGGAGGTAAAACCTGGTGGG No data
1156670078_1156670087 12 Left 1156670078 18:39458466-39458488 CCCACCCAAATCTCATGTTGAAA 0: 186
1: 1481
2: 12166
3: 15604
4: 12861
Right 1156670087 18:39458501-39458523 TGTTGGAGGTAAAACCTGGTGGG No data
1156670077_1156670087 13 Left 1156670077 18:39458465-39458487 CCCCACCCAAATCTCATGTTGAA 0: 1001
1: 9794
2: 12757
3: 9934
4: 6663
Right 1156670087 18:39458501-39458523 TGTTGGAGGTAAAACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156670087 Original CRISPR TGTTGGAGGTAAAACCTGGT GGG Intergenic
No off target data available for this crispr