ID: 1156671271

View in Genome Browser
Species Human (GRCh38)
Location 18:39472960-39472982
Sequence TTGAGAATGACTACTATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156671267_1156671271 5 Left 1156671267 18:39472932-39472954 CCTCTCATGAGCGGGGCTTGAGG No data
Right 1156671271 18:39472960-39472982 TTGAGAATGACTACTATTGCTGG No data
1156671266_1156671271 6 Left 1156671266 18:39472931-39472953 CCCTCTCATGAGCGGGGCTTGAG No data
Right 1156671271 18:39472960-39472982 TTGAGAATGACTACTATTGCTGG No data
1156671265_1156671271 7 Left 1156671265 18:39472930-39472952 CCCCTCTCATGAGCGGGGCTTGA No data
Right 1156671271 18:39472960-39472982 TTGAGAATGACTACTATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156671271 Original CRISPR TTGAGAATGACTACTATTGC TGG Intergenic
No off target data available for this crispr