ID: 1156680489

View in Genome Browser
Species Human (GRCh38)
Location 18:39582670-39582692
Sequence ATGTGGGTTTCTTGCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156680489_1156680492 -5 Left 1156680489 18:39582670-39582692 CCATTTTGGCAAGAAACCCACAT No data
Right 1156680492 18:39582688-39582710 CACATGTGTAGCTATTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156680489 Original CRISPR ATGTGGGTTTCTTGCCAAAA TGG (reversed) Intergenic
No off target data available for this crispr