ID: 1156689540

View in Genome Browser
Species Human (GRCh38)
Location 18:39691408-39691430
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156689540_1156689542 7 Left 1156689540 18:39691408-39691430 CCATTAGATACAAAGCAGAATGT No data
Right 1156689542 18:39691438-39691460 GGTTATAATTCAACCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156689540 Original CRISPR ACATTCTGCTTTGTATCTAA TGG (reversed) Intergenic
No off target data available for this crispr