ID: 1156689542

View in Genome Browser
Species Human (GRCh38)
Location 18:39691438-39691460
Sequence GGTTATAATTCAACCTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156689540_1156689542 7 Left 1156689540 18:39691408-39691430 CCATTAGATACAAAGCAGAATGT No data
Right 1156689542 18:39691438-39691460 GGTTATAATTCAACCTTTTCAGG No data
1156689539_1156689542 24 Left 1156689539 18:39691391-39691413 CCTTAAGAAAAGCGTAGCCATTA No data
Right 1156689542 18:39691438-39691460 GGTTATAATTCAACCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156689542 Original CRISPR GGTTATAATTCAACCTTTTC AGG Intergenic
No off target data available for this crispr