ID: 1156690352

View in Genome Browser
Species Human (GRCh38)
Location 18:39700137-39700159
Sequence CAATGTGAGCCTTGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156690352_1156690360 27 Left 1156690352 18:39700137-39700159 CCTGCTTCCCAAGGCTCACATTG No data
Right 1156690360 18:39700187-39700209 CAGCCAGCAACTCTCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156690352 Original CRISPR CAATGTGAGCCTTGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr