ID: 1156692878

View in Genome Browser
Species Human (GRCh38)
Location 18:39729494-39729516
Sequence ATTAGGAAAATGAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156692878_1156692884 23 Left 1156692878 18:39729494-39729516 CCTTCAGGGTTCATTTTCCTAAT No data
Right 1156692884 18:39729540-39729562 TAAATCCTGCAGAGGGTGAGTGG No data
1156692878_1156692881 16 Left 1156692878 18:39729494-39729516 CCTTCAGGGTTCATTTTCCTAAT No data
Right 1156692881 18:39729533-39729555 ATCCCAGTAAATCCTGCAGAGGG No data
1156692878_1156692880 15 Left 1156692878 18:39729494-39729516 CCTTCAGGGTTCATTTTCCTAAT No data
Right 1156692880 18:39729532-39729554 AATCCCAGTAAATCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156692878 Original CRISPR ATTAGGAAAATGAACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr