ID: 1156696910

View in Genome Browser
Species Human (GRCh38)
Location 18:39778561-39778583
Sequence TGTGCCTCCCTTACTATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156696910_1156696918 1 Left 1156696910 18:39778561-39778583 CCTCCCATAGTAAGGGAGGCACA No data
Right 1156696918 18:39778585-39778607 CCTGGGGAGAAGGAGATAGAAGG No data
1156696910_1156696919 2 Left 1156696910 18:39778561-39778583 CCTCCCATAGTAAGGGAGGCACA No data
Right 1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG No data
1156696910_1156696916 -9 Left 1156696910 18:39778561-39778583 CCTCCCATAGTAAGGGAGGCACA No data
Right 1156696916 18:39778575-39778597 GGAGGCACAGCCTGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156696910 Original CRISPR TGTGCCTCCCTTACTATGGG AGG (reversed) Intergenic
No off target data available for this crispr