ID: 1156697954

View in Genome Browser
Species Human (GRCh38)
Location 18:39790642-39790664
Sequence CAGAACAAGGATTAGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156697943_1156697954 27 Left 1156697943 18:39790592-39790614 CCCATGTATATGCCTAAAACACA No data
Right 1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG No data
1156697945_1156697954 15 Left 1156697945 18:39790604-39790626 CCTAAAACACACTGTAAACTGAG No data
Right 1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG No data
1156697942_1156697954 28 Left 1156697942 18:39790591-39790613 CCCCATGTATATGCCTAAAACAC No data
Right 1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG No data
1156697944_1156697954 26 Left 1156697944 18:39790593-39790615 CCATGTATATGCCTAAAACACAC No data
Right 1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156697954 Original CRISPR CAGAACAAGGATTAGGGGTA GGG Intergenic
No off target data available for this crispr