ID: 1156705735

View in Genome Browser
Species Human (GRCh38)
Location 18:39879293-39879315
Sequence CAGTCTCTGCATCCTGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156705734_1156705735 3 Left 1156705734 18:39879267-39879289 CCTTGAACAAGCTATTCTTTGAA No data
Right 1156705735 18:39879293-39879315 CAGTCTCTGCATCCTGTAAAAGG No data
1156705733_1156705735 29 Left 1156705733 18:39879241-39879263 CCAGGCAGGTCAGAGCTCAAGAA No data
Right 1156705735 18:39879293-39879315 CAGTCTCTGCATCCTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156705735 Original CRISPR CAGTCTCTGCATCCTGTAAA AGG Intergenic
No off target data available for this crispr