ID: 1156708195

View in Genome Browser
Species Human (GRCh38)
Location 18:39909542-39909564
Sequence ATGGAGGAGCAGCTTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156708195_1156708198 -4 Left 1156708195 18:39909542-39909564 CCTTTCTCAAGCTGCTCCTCCAT No data
Right 1156708198 18:39909561-39909583 CCATGTGAATCCCCTGTACCAGG No data
1156708195_1156708199 0 Left 1156708195 18:39909542-39909564 CCTTTCTCAAGCTGCTCCTCCAT No data
Right 1156708199 18:39909565-39909587 GTGAATCCCCTGTACCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156708195 Original CRISPR ATGGAGGAGCAGCTTGAGAA AGG (reversed) Intergenic
No off target data available for this crispr