ID: 1156710650

View in Genome Browser
Species Human (GRCh38)
Location 18:39940754-39940776
Sequence TTACTACTCATTAAAGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156710650_1156710654 18 Left 1156710650 18:39940754-39940776 CCTACCACTTTAATGAGTAGTAA No data
Right 1156710654 18:39940795-39940817 AATCCATCAATCAGCCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156710650 Original CRISPR TTACTACTCATTAAAGTGGT AGG (reversed) Intergenic
No off target data available for this crispr