ID: 1156710683

View in Genome Browser
Species Human (GRCh38)
Location 18:39941234-39941256
Sequence GTGAGCAATAGAAAGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156710682_1156710683 17 Left 1156710682 18:39941194-39941216 CCAAGTTCACAGCACAAAATACA No data
Right 1156710683 18:39941234-39941256 GTGAGCAATAGAAAGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156710683 Original CRISPR GTGAGCAATAGAAAGACAGC TGG Intergenic
No off target data available for this crispr