ID: 1156711181

View in Genome Browser
Species Human (GRCh38)
Location 18:39947862-39947884
Sequence ATGGGGTCCTGTTTTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156711181_1156711187 30 Left 1156711181 18:39947862-39947884 CCACCAAGAAAACAGGACCCCAT No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156711181 Original CRISPR ATGGGGTCCTGTTTTCTTGG TGG (reversed) Intergenic