ID: 1156711182

View in Genome Browser
Species Human (GRCh38)
Location 18:39947865-39947887
Sequence AGTATGGGGTCCTGTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156711182_1156711187 27 Left 1156711182 18:39947865-39947887 CCAAGAAAACAGGACCCCATACT No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156711182 Original CRISPR AGTATGGGGTCCTGTTTTCT TGG (reversed) Intergenic