ID: 1156711185 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:39947880-39947902 |
| Sequence | TGACTTTCCATAACAAGTAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156711185_1156711187 | 12 | Left | 1156711185 | 18:39947880-39947902 | CCCATACTTGTTATGGAAAGTCA | No data | ||
| Right | 1156711187 | 18:39947915-39947937 | CATTGTGCTCTAAGTTTAGATGG | 0: 1 1: 0 2: 2 3: 5 4: 123 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156711185 | Original CRISPR | TGACTTTCCATAACAAGTAT GGG (reversed) | Intergenic | ||