ID: 1156711185

View in Genome Browser
Species Human (GRCh38)
Location 18:39947880-39947902
Sequence TGACTTTCCATAACAAGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156711185_1156711187 12 Left 1156711185 18:39947880-39947902 CCCATACTTGTTATGGAAAGTCA No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156711185 Original CRISPR TGACTTTCCATAACAAGTAT GGG (reversed) Intergenic