ID: 1156711187

View in Genome Browser
Species Human (GRCh38)
Location 18:39947915-39947937
Sequence CATTGTGCTCTAAGTTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156711186_1156711187 11 Left 1156711186 18:39947881-39947903 CCATACTTGTTATGGAAAGTCAT No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data
1156711184_1156711187 13 Left 1156711184 18:39947879-39947901 CCCCATACTTGTTATGGAAAGTC No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data
1156711185_1156711187 12 Left 1156711185 18:39947880-39947902 CCCATACTTGTTATGGAAAGTCA No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data
1156711182_1156711187 27 Left 1156711182 18:39947865-39947887 CCAAGAAAACAGGACCCCATACT No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data
1156711181_1156711187 30 Left 1156711181 18:39947862-39947884 CCACCAAGAAAACAGGACCCCAT No data
Right 1156711187 18:39947915-39947937 CATTGTGCTCTAAGTTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156711187 Original CRISPR CATTGTGCTCTAAGTTTAGA TGG Intergenic