ID: 1156712675

View in Genome Browser
Species Human (GRCh38)
Location 18:39965854-39965876
Sequence CCTCCCCAGCACCATTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156712675_1156712678 -7 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712678 18:39965870-39965892 GGGGAGGCCCTAAAATCTCTGGG No data
1156712675_1156712687 25 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712687 18:39965902-39965924 GACATGGTATAGAGGATATTGGG No data
1156712675_1156712677 -8 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712677 18:39965869-39965891 TGGGGAGGCCCTAAAATCTCTGG No data
1156712675_1156712684 17 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712684 18:39965894-39965916 CCCAGAAAGACATGGTATAGAGG No data
1156712675_1156712681 9 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712681 18:39965886-39965908 CTCTGGGCCCCAGAAAGACATGG No data
1156712675_1156712686 24 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712686 18:39965901-39965923 AGACATGGTATAGAGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156712675 Original CRISPR CCTCCCCAGCACCATTAGAA TGG (reversed) Intergenic
No off target data available for this crispr