ID: 1156712679

View in Genome Browser
Species Human (GRCh38)
Location 18:39965877-39965899
Sequence TCTGGGGCCCAGAGATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156712679_1156712686 1 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712686 18:39965901-39965923 AGACATGGTATAGAGGATATTGG No data
1156712679_1156712688 11 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data
1156712679_1156712687 2 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712687 18:39965902-39965924 GACATGGTATAGAGGATATTGGG No data
1156712679_1156712689 17 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712689 18:39965917-39965939 ATATTGGGAGAAAGTGGCCTTGG No data
1156712679_1156712684 -6 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712684 18:39965894-39965916 CCCAGAAAGACATGGTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156712679 Original CRISPR TCTGGGGCCCAGAGATTTTA GGG (reversed) Intergenic
No off target data available for this crispr