ID: 1156712680

View in Genome Browser
Species Human (GRCh38)
Location 18:39965878-39965900
Sequence TTCTGGGGCCCAGAGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156712680_1156712686 0 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712686 18:39965901-39965923 AGACATGGTATAGAGGATATTGG No data
1156712680_1156712689 16 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712689 18:39965917-39965939 ATATTGGGAGAAAGTGGCCTTGG No data
1156712680_1156712684 -7 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712684 18:39965894-39965916 CCCAGAAAGACATGGTATAGAGG No data
1156712680_1156712687 1 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712687 18:39965902-39965924 GACATGGTATAGAGGATATTGGG No data
1156712680_1156712690 30 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712690 18:39965931-39965953 TGGCCTTGGTGACTGAGTGAAGG No data
1156712680_1156712688 10 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156712680 Original CRISPR TTCTGGGGCCCAGAGATTTT AGG (reversed) Intergenic
No off target data available for this crispr