ID: 1156712686

View in Genome Browser
Species Human (GRCh38)
Location 18:39965901-39965923
Sequence AGACATGGTATAGAGGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156712679_1156712686 1 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712686 18:39965901-39965923 AGACATGGTATAGAGGATATTGG No data
1156712675_1156712686 24 Left 1156712675 18:39965854-39965876 CCATTCTAATGGTGCTGGGGAGG No data
Right 1156712686 18:39965901-39965923 AGACATGGTATAGAGGATATTGG No data
1156712680_1156712686 0 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712686 18:39965901-39965923 AGACATGGTATAGAGGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156712686 Original CRISPR AGACATGGTATAGAGGATAT TGG Intergenic
No off target data available for this crispr