ID: 1156712688

View in Genome Browser
Species Human (GRCh38)
Location 18:39965911-39965933
Sequence TAGAGGATATTGGGAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156712682_1156712688 -5 Left 1156712682 18:39965893-39965915 CCCCAGAAAGACATGGTATAGAG No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data
1156712680_1156712688 10 Left 1156712680 18:39965878-39965900 CCTAAAATCTCTGGGCCCCAGAA No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data
1156712679_1156712688 11 Left 1156712679 18:39965877-39965899 CCCTAAAATCTCTGGGCCCCAGA No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data
1156712683_1156712688 -6 Left 1156712683 18:39965894-39965916 CCCAGAAAGACATGGTATAGAGG No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data
1156712685_1156712688 -7 Left 1156712685 18:39965895-39965917 CCAGAAAGACATGGTATAGAGGA No data
Right 1156712688 18:39965911-39965933 TAGAGGATATTGGGAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156712688 Original CRISPR TAGAGGATATTGGGAGAAAG TGG Intergenic
No off target data available for this crispr