ID: 1156733131

View in Genome Browser
Species Human (GRCh38)
Location 18:40220585-40220607
Sequence TGATTCTAGGGTCAGATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156733131_1156733136 25 Left 1156733131 18:40220585-40220607 CCACATATCTGACCCTAGAATCA No data
Right 1156733136 18:40220633-40220655 CTCATAGCAAGATTTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156733131 Original CRISPR TGATTCTAGGGTCAGATATG TGG (reversed) Intergenic
No off target data available for this crispr