ID: 1156739072

View in Genome Browser
Species Human (GRCh38)
Location 18:40301805-40301827
Sequence GAGATCTATCTTTTCGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156739070_1156739072 5 Left 1156739070 18:40301777-40301799 CCTTAGATGTAATGTTAGGTTTT No data
Right 1156739072 18:40301805-40301827 GAGATCTATCTTTTCGATGGAGG No data
1156739069_1156739072 6 Left 1156739069 18:40301776-40301798 CCCTTAGATGTAATGTTAGGTTT No data
Right 1156739072 18:40301805-40301827 GAGATCTATCTTTTCGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156739072 Original CRISPR GAGATCTATCTTTTCGATGG AGG Intergenic
No off target data available for this crispr