ID: 1156740521

View in Genome Browser
Species Human (GRCh38)
Location 18:40321907-40321929
Sequence CCAATGTGGTAGGAGACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156740514_1156740521 6 Left 1156740514 18:40321878-40321900 CCATCCAAATCTCATTTGAATTA No data
Right 1156740521 18:40321907-40321929 CCAATGTGGTAGGAGACGCCTGG No data
1156740515_1156740521 2 Left 1156740515 18:40321882-40321904 CCAAATCTCATTTGAATTATAAT No data
Right 1156740521 18:40321907-40321929 CCAATGTGGTAGGAGACGCCTGG No data
1156740513_1156740521 27 Left 1156740513 18:40321857-40321879 CCAACTATATGGTTTGTGTCTCC No data
Right 1156740521 18:40321907-40321929 CCAATGTGGTAGGAGACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156740521 Original CRISPR CCAATGTGGTAGGAGACGCC TGG Intergenic
No off target data available for this crispr