ID: 1156741635

View in Genome Browser
Species Human (GRCh38)
Location 18:40337515-40337537
Sequence GGCTTAAAACAAATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156741631_1156741635 28 Left 1156741631 18:40337464-40337486 CCAAATGTCTTCATGAGTATGGT No data
Right 1156741635 18:40337515-40337537 GGCTTAAAACAAATGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156741635 Original CRISPR GGCTTAAAACAAATGAAGCA TGG Intergenic
No off target data available for this crispr