ID: 1156742333

View in Genome Browser
Species Human (GRCh38)
Location 18:40347117-40347139
Sequence ATATGGTCATTCCAAATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156742333_1156742340 24 Left 1156742333 18:40347117-40347139 CCATGCATTTGGAATGACCATAT No data
Right 1156742340 18:40347164-40347186 TGATGGCACCAAGTTAACCATGG No data
1156742333_1156742338 7 Left 1156742333 18:40347117-40347139 CCATGCATTTGGAATGACCATAT No data
Right 1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG No data
1156742333_1156742336 -8 Left 1156742333 18:40347117-40347139 CCATGCATTTGGAATGACCATAT No data
Right 1156742336 18:40347132-40347154 GACCATATGGGTTTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156742333 Original CRISPR ATATGGTCATTCCAAATGCA TGG (reversed) Intergenic
No off target data available for this crispr