ID: 1156742337

View in Genome Browser
Species Human (GRCh38)
Location 18:40347134-40347156
Sequence CACCAGGCAGAAAACCCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156742337_1156742338 -10 Left 1156742337 18:40347134-40347156 CCATATGGGTTTTCTGCCTGGTG No data
Right 1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG No data
1156742337_1156742340 7 Left 1156742337 18:40347134-40347156 CCATATGGGTTTTCTGCCTGGTG No data
Right 1156742340 18:40347164-40347186 TGATGGCACCAAGTTAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156742337 Original CRISPR CACCAGGCAGAAAACCCATA TGG (reversed) Intergenic
No off target data available for this crispr