ID: 1156742338

View in Genome Browser
Species Human (GRCh38)
Location 18:40347147-40347169
Sequence CTGCCTGGTGACTGTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156742337_1156742338 -10 Left 1156742337 18:40347134-40347156 CCATATGGGTTTTCTGCCTGGTG No data
Right 1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG No data
1156742333_1156742338 7 Left 1156742333 18:40347117-40347139 CCATGCATTTGGAATGACCATAT No data
Right 1156742338 18:40347147-40347169 CTGCCTGGTGACTGTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156742338 Original CRISPR CTGCCTGGTGACTGTGTTGA TGG Intergenic
No off target data available for this crispr