ID: 1156746295

View in Genome Browser
Species Human (GRCh38)
Location 18:40395505-40395527
Sequence TCATTACCACAGGTTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156746291_1156746295 3 Left 1156746291 18:40395479-40395501 CCATTTGGCTCCAGATCAATGTT No data
Right 1156746295 18:40395505-40395527 TCATTACCACAGGTTGAACAGGG No data
1156746292_1156746295 -7 Left 1156746292 18:40395489-40395511 CCAGATCAATGTTTCTTCATTAC No data
Right 1156746295 18:40395505-40395527 TCATTACCACAGGTTGAACAGGG No data
1156746289_1156746295 18 Left 1156746289 18:40395464-40395486 CCAAGCAGTATCAGACCATTTGG No data
Right 1156746295 18:40395505-40395527 TCATTACCACAGGTTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156746295 Original CRISPR TCATTACCACAGGTTGAACA GGG Intergenic
No off target data available for this crispr