ID: 1156746582 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:40399328-40399350 |
| Sequence | AAGCAGTTGTATCTTGGTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1156746582_1156746586 | -3 | Left | 1156746582 | 18:40399328-40399350 | CCTTGACCAAGATACAACTGCTT | No data | ||
| Right | 1156746586 | 18:40399348-40399370 | CTTCTCAGACAGGGTTTTACAGG | No data | ||||
| 1156746582_1156746587 | -2 | Left | 1156746582 | 18:40399328-40399350 | CCTTGACCAAGATACAACTGCTT | No data | ||
| Right | 1156746587 | 18:40399349-40399371 | TTCTCAGACAGGGTTTTACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1156746582 | Original CRISPR | AAGCAGTTGTATCTTGGTCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||