ID: 1156746582

View in Genome Browser
Species Human (GRCh38)
Location 18:40399328-40399350
Sequence AAGCAGTTGTATCTTGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156746582_1156746586 -3 Left 1156746582 18:40399328-40399350 CCTTGACCAAGATACAACTGCTT No data
Right 1156746586 18:40399348-40399370 CTTCTCAGACAGGGTTTTACAGG No data
1156746582_1156746587 -2 Left 1156746582 18:40399328-40399350 CCTTGACCAAGATACAACTGCTT No data
Right 1156746587 18:40399349-40399371 TTCTCAGACAGGGTTTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156746582 Original CRISPR AAGCAGTTGTATCTTGGTCA AGG (reversed) Intergenic
No off target data available for this crispr