ID: 1156758329

View in Genome Browser
Species Human (GRCh38)
Location 18:40556167-40556189
Sequence AGTTAGCTTCAGCAGTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156758329_1156758331 -3 Left 1156758329 18:40556167-40556189 CCTGTCAACTGCTGAAGCTAACT No data
Right 1156758331 18:40556187-40556209 ACTAGGCCTGAAGATGTGCCTGG No data
1156758329_1156758333 11 Left 1156758329 18:40556167-40556189 CCTGTCAACTGCTGAAGCTAACT No data
Right 1156758333 18:40556201-40556223 TGTGCCTGGCTTCACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156758329 Original CRISPR AGTTAGCTTCAGCAGTTGAC AGG (reversed) Intergenic
No off target data available for this crispr