ID: 1156760099

View in Genome Browser
Species Human (GRCh38)
Location 18:40578325-40578347
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156760099_1156760100 10 Left 1156760099 18:40578325-40578347 CCTGAGAAAATACTACAGACAGC No data
Right 1156760100 18:40578358-40578380 TACACTCCTTAACACATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156760099 Original CRISPR GCTGTCTGTAGTATTTTCTC AGG (reversed) Intergenic
No off target data available for this crispr