ID: 1156771348

View in Genome Browser
Species Human (GRCh38)
Location 18:40730506-40730528
Sequence GTGGAAAACCACACTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156771348_1156771352 30 Left 1156771348 18:40730506-40730528 CCAATAAAAGTGTGGTTTTCCAC No data
Right 1156771352 18:40730559-40730581 TTTTATTAGTTAATACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156771348 Original CRISPR GTGGAAAACCACACTTTTAT TGG (reversed) Intergenic
No off target data available for this crispr