ID: 1156772162

View in Genome Browser
Species Human (GRCh38)
Location 18:40741779-40741801
Sequence CTTTGGCTGCAGGTGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156772162_1156772168 11 Left 1156772162 18:40741779-40741801 CCTTGTACCACCTGCAGCCAAAG No data
Right 1156772168 18:40741813-40741835 TATTTTTCTCTGAGTGGAGTGGG No data
1156772162_1156772169 18 Left 1156772162 18:40741779-40741801 CCTTGTACCACCTGCAGCCAAAG No data
Right 1156772169 18:40741820-40741842 CTCTGAGTGGAGTGGGCAGCTGG No data
1156772162_1156772166 5 Left 1156772162 18:40741779-40741801 CCTTGTACCACCTGCAGCCAAAG No data
Right 1156772166 18:40741807-40741829 TGCATGTATTTTTCTCTGAGTGG No data
1156772162_1156772167 10 Left 1156772162 18:40741779-40741801 CCTTGTACCACCTGCAGCCAAAG No data
Right 1156772167 18:40741812-40741834 GTATTTTTCTCTGAGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156772162 Original CRISPR CTTTGGCTGCAGGTGGTACA AGG (reversed) Intergenic
No off target data available for this crispr