ID: 1156777512

View in Genome Browser
Species Human (GRCh38)
Location 18:40810625-40810647
Sequence CTTTATGAGCAGAAGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156777506_1156777512 -10 Left 1156777506 18:40810612-40810634 CCTGGGCTGCCCTCTTTATGAGC No data
Right 1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG No data
1156777501_1156777512 29 Left 1156777501 18:40810573-40810595 CCAGAGGCAAGGTCATTATCTGA No data
Right 1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG No data
1156777505_1156777512 -6 Left 1156777505 18:40810608-40810630 CCTACCTGGGCTGCCCTCTTTAT No data
Right 1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG No data
1156777500_1156777512 30 Left 1156777500 18:40810572-40810594 CCCAGAGGCAAGGTCATTATCTG No data
Right 1156777512 18:40810625-40810647 CTTTATGAGCAGAAGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156777512 Original CRISPR CTTTATGAGCAGAAGTGGAG GGG Intergenic
No off target data available for this crispr