ID: 1156780094

View in Genome Browser
Species Human (GRCh38)
Location 18:40840364-40840386
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156780091_1156780094 17 Left 1156780091 18:40840324-40840346 CCTCAGGTATGAAGTCAAACTGA No data
Right 1156780094 18:40840364-40840386 ATAAAGTATCTGGCCAGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156780094 Original CRISPR ATAAAGTATCTGGCCAGGCA CGG Intergenic
No off target data available for this crispr