ID: 1156780867

View in Genome Browser
Species Human (GRCh38)
Location 18:40849025-40849047
Sequence CAAATCAGAATTCCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156780865_1156780867 17 Left 1156780865 18:40848985-40849007 CCATTCTATGCTATTAGTTTGAT No data
Right 1156780867 18:40849025-40849047 CAAATCAGAATTCCTGTTCCAGG No data
1156780864_1156780867 26 Left 1156780864 18:40848976-40848998 CCAGGTAGTCCATTCTATGCTAT No data
Right 1156780867 18:40849025-40849047 CAAATCAGAATTCCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156780867 Original CRISPR CAAATCAGAATTCCTGTTCC AGG Intergenic
No off target data available for this crispr