ID: 1156781110

View in Genome Browser
Species Human (GRCh38)
Location 18:40852038-40852060
Sequence TAGATGACCCACTGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156781110_1156781113 0 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781113 18:40852061-40852083 AACACTTGTACTCATGGCCATGG No data
1156781110_1156781117 29 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781117 18:40852090-40852112 TGGGACTAATTTCACAGAGATGG No data
1156781110_1156781118 30 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781118 18:40852091-40852113 GGGACTAATTTCACAGAGATGGG No data
1156781110_1156781114 9 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781114 18:40852070-40852092 ACTCATGGCCATGGTCTCACTGG No data
1156781110_1156781112 -6 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781112 18:40852055-40852077 CATCTAAACACTTGTACTCATGG No data
1156781110_1156781115 10 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781115 18:40852071-40852093 CTCATGGCCATGGTCTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156781110 Original CRISPR TAGATGACCCACTGAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr