ID: 1156781112

View in Genome Browser
Species Human (GRCh38)
Location 18:40852055-40852077
Sequence CATCTAAACACTTGTACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1156781110_1156781112 -6 Left 1156781110 18:40852038-40852060 CCAGCTCCTCAGTGGGTCATCTA No data
Right 1156781112 18:40852055-40852077 CATCTAAACACTTGTACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1156781112 Original CRISPR CATCTAAACACTTGTACTCA TGG Intergenic
No off target data available for this crispr